CLK1 (NM_004071) Human 3' UTR Clone

CAT#: SC203893

3' UTR clone of CDC-like kinase 1 (CLK1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CLK1 (NM_004071) Human 3' UTR Clone
Vector pMirTarget
Synonyms CLK; CLK/STY; STY
ACCN NM_004071
Insert Size 327 bp
Sequence Data
>SC203893 3’UTR clone of NM_004071
The sequence shown below is from the reference sequence of NM_004071. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCTTTGACCTTCTGAAGAAAAGTATATAGATCTGTAATTGGACAGCTCTCTCGAAGAGATCTTACAGA
CTGTATCAGTCTAATTTTTAAATTTTAAGTTATTTTGTACAGCTTTGTAAATTCTTAACATTTTTATAT
TGCCATGTTTATTTTGTTTGGGTAATTTGGTTCATTAAGTACATAGCTAAGGTAATGAACATCTTTTTC
AGTAATTGTAAAGTGATTTATTCAGAATAAATTTTTTGTGCTTATGAAGTTGATATGTATCTGAACAGT
TTGTTCTAAGTACCATTTTTCTTCCTACTTCTATTAAAGAATGGACATAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004071.4
Synonyms CLK; CLK/STY; STY
Summary This gene encodes a member of the CDC2-like (or LAMMER) family of dual specificity protein kinases. In the nucleus, the encoded protein phosphorylates serine/arginine-rich proteins involved in pre-mRNA processing, releasing them into the nucleoplasm. The choice of splice sites during pre-mRNA processing may be regulated by the concentration of transacting factors, including serine/arginine rich proteins. Therefore, the encoded protein may play an indirect role in governing splice site selection. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
Locus ID 1195
MW 13.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...