C11orf51 (ANAPC15) (NM_014042) Human 3' UTR Clone

CAT#: SC203824

3' UTR clone of chromosome 11 open reading frame 51 (C11orf51) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name C11orf51 (ANAPC15) (NM_014042) Human 3' UTR Clone
Vector pMirTarget
Synonyms APC15; C11orf51; HSPC020
ACCN NM_014042
Insert Size 324 bp
Sequence Data
>SC203824 3’UTR clone of NM_014042
The sequence shown below is from the reference sequence of NM_014042. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAACAGGATCAGGACCAGTGGATGATCTAGGTAGACAAGGCAGGGTGGCCTCAGGGAGATTCCAGGCCA
GCCCAAACTACCCTGCATCCCAACCCCCAACCCCTGCCCACAGAACCAGCTGATGGCCCCAGTGCCTGA
AAGTGCCCTTGGGCACCTCCTCAGCTGCTGCCAGGATCTGGTCTCTTTGGCCCCTCCCAGGCCATCAGT
CTGCACTTGAAATCCCCAGGGCCTGAAACCTACTCCACCTTCCTGGCCAGTACCTCACCCCTTGATTGC
CAGGTCTGGTCTAAGTTTCTTTAATAAAGACAAAGGAGTGATTTTCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014042.3
Synonyms APC15; C11orf51; HSPC020
Summary Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. In the complex, plays a role in the release of the mitotic checkpoint complex (MCC) from the APC/C: not required for APC/C activity itself, but promotes the turnover of CDC20 and MCC on the APC/C, thereby participating in the responsiveness of the spindle assembly checkpoint. Also required for degradation of CDC20.[UniProtKB/Swiss-Prot Function]
Locus ID 25906
MW 11.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...