HSD17B1 (NM_000413) Human 3' UTR Clone

CAT#: SC203818

3' UTR clone of hydroxysteroid (17-beta) dehydrogenase 1 (HSD17B1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HSD17B1 (NM_000413) Human 3' UTR Clone
Vector pMirTarget
Synonyms 17-beta-HSD; 20-alpha-HSD; E2DH; EDH17B2; EDHB17; HSD17; SDR28C1
ACCN NM_000413
Insert Size 306 bp
Sequence Data
>SC203818 3’UTR clone of NM_000413
The sequence shown below is from the reference sequence of NM_000413. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCGGCGATCCTCCGGCCGCCCCGCAGTAAAGGCTTCCTCAGCCGCTGTCTCCCGCGCCCTTCTTTGTC
CCCTGGGTCTGTGTGGTCCCTGGGGATGGGGCGGCGGTAGCAGCTGTGGGTGGCTAATTAAGATAGATC
GCGTTAGCCAGTTTTACCAGCGCAGCTAGGCGCGATGGCTGTCGCCTGTAATGCCAGCGCTTTGGGAGG
CGGAGGCAGGAGGATCGCTCAAGCCCCGGAGTTGGAGACCAGCCAGAGCAACACAGTGAGACCCCCATC
TCTACAAAAATAAAGAAAATTTAAAAATCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000413.4
Synonyms 17-beta-HSD; 20-alpha-HSD; E2DH; EDH17B2; EDHB17; HSD17; SDR28C1
Summary This gene encodes a member of the 17beta-hydroxysteroid dehydrogenase family of short-chain dehydrogenases/reductases. It has a dual function in estrogen activation and androgen inactivation and plays a major role in establishing the estrogen E2 concentration gradient between serum and peripheral tissues. The encoded protein catalyzes the last step in estrogen activation, using NADPH to convert estrogens E1 and E2 and androgens like 4-androstenedione, to testosterone. It has an N-terminal short-chain dehydrogenase domain with a cofactor binding site, and a narrow, hydrophobic C-terminal domain with a steroid substrate binding site. This gene is expressed primarily in the placenta and ovarian granulosa cells, and to a lesser extent, in the endometrium, adipose tissue, and prostate. Polymorphisms in this gene have been linked to breast and prostate cancer. A pseudogene of this gene has been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Locus ID 3292
MW 10.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...