KCNH5 (NM_139318) Human 3' UTR Clone

CAT#: SC203758

3' UTR clone of potassium voltage-gated channel subfamily H (eag-related) member 5 (KCNH5) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name KCNH5 (NM_139318) Human 3' UTR Clone
Vector pMirTarget
Synonyms EAG2; H-EAG2; hEAG2; Kv10.2
ACCN NM_139318
Insert Size 322 bp
Sequence Data
>SC203758 3' UTR clone of NM_139318
The sequence shown below is from the reference sequence of NM_139318. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCCTGAATCACCTGAATCTGACAAAGATGAAATCCACTTTTAATATATATACATATATATTTGTTAATAT
ATTAAAACAGTATATACATATGTGTGTATATACAGTATATACATATATATATTTTCACTTGCTTTCAAGA
TGATGACCACACATGGATTTTGATATGTAAATATTGCATGTCCAGCTGGATTCTGGCCTGCCAAAGAAGA
TGATGATTAAAAACATAGATATTGCTTGTATATTATGCAGTTGACTGCATGCACACTTTACATTTATTTA
TAATCTCTATTCTATAATAAAAGAGTATGATTTTTGTTACCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_139318.3
Synonyms EAG2; H-EAG2; hEAG2; Kv10.2
Summary This gene encodes a member of voltage-gated potassium channels. Members of this family have diverse functions, including regulating neurotransmitter and hormone release, cardiac function, and cell volume. This protein is an outward-rectifying, noninactivating channel. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Locus ID 27133
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...