MMP10 (NM_002425) Human 3' UTR Clone

CAT#: SC203755

3' UTR clone of matrix metallopeptidase 10 (stromelysin 2) (MMP10) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MMP10 (NM_002425) Human 3' UTR Clone
Vector pMirTarget
Synonyms SL-2; STMY2
ACCN NM_002425
Insert Size 321 bp
Sequence Data
>SC203755 3’UTR clone of NM_002425
The sequence shown below is from the reference sequence of NM_002425. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTAAAGAGTAACAGCTGGTTACATTGCTAGGCGAGATAGGGGGAAGACAGATATGGGTGTTTTTAATAA
ATCTAATAATTATTCATCTAATGTATTATGAGCCAAAATGGTTAATTTTTCCTGCATGTTCTGTGACTG
AAGAAGATGAGCCTTGCAGATATCTGCATGTGTCATGAAGAATGTTTCTGGAATTCTTCACTTGCTTTT
GAATTGCACTGAACAGAATTAAGAAATACTCATGTGCAATAGGTGAGAGAATGTATTTTCATAGATGTG
TTATTACTTCCTCAATAAAAAGTTTTATTTTGGGCCTGTTCCTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002425.3
Synonyms SL-2; STMY2
Summary This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This secreted protease breaks down fibronectin, laminin, elastin, proteoglycan core protein, gelatins, and several types of collagen. The gene is part of a cluster of MMP genes on chromosome 11. [provided by RefSeq, Jan 2016]
Locus ID 4319
MW 12.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...