KPNA2 (NM_002266) Human 3' UTR Clone

CAT#: SC203750

3' UTR clone of karyopherin alpha 2 (RAG cohort 1 importin alpha 1) (KPNA2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name KPNA2 (NM_002266) Human 3' UTR Clone
Vector pMirTarget
Synonyms IPOA1; QIP2; RCH1; SRP1-alpha; SRP1alpha
ACCN NM_002266
Insert Size 288 bp
Sequence Data
>SC203750 3’UTR clone of NM_002266
The sequence shown below is from the reference sequence of NM_002266. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATGGGGCTCCTGGGACCTTTAACTTTTAGATCATGTAGCTGAGACATAAATTTGTTGTGTACTACGTT
TGGTATTTTGTCTTATTGTTTCTCTACTAAGAACTCTTTCTTAAATGTGGTTTGTTACTGTAGCACTTT
TTACACTGAAACTATACTTGAACAGTTCCAACTGTACATACATACTGTATGAAGCTTGTCCTCTGACTA
GGTTTCTAATTTCTATGTGGAATTTCCTATCTTGCAGCATCCTGTAAATAAACATTCAAGTCCACCCTT
TTCTTGACTTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002266.4
Synonyms IPOA1; QIP2; RCH1; SRP1-alpha; SRP1alpha
Summary The import of proteins into the nucleus is a process that involves at least 2 steps. The first is an energy-independent docking of the protein to the nuclear envelope and the second is an energy-dependent translocation through the nuclear pore complex. Imported proteins require a nuclear localization sequence (NLS) which generally consists of a short region of basic amino acids or 2 such regions spaced about 10 amino acids apart. Proteins involved in the first step of nuclear import have been identified in different systems. These include the Xenopus protein importin and its yeast homolog, SRP1 (a suppressor of certain temperature-sensitive mutations of RNA polymerase I in Saccharomyces cerevisiae), which bind to the NLS. KPNA2 protein interacts with the NLSs of DNA helicase Q1 and SV40 T antigen and may be involved in the nuclear transport of proteins. KPNA2 also may play a role in V(D)J recombination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Locus ID 3838
MW 11.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...