FANCG (NM_004629) Human 3' UTR Clone

CAT#: SC203728

3' UTR clone of Fanconi anemia complementation group G (FANCG) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FANCG (NM_004629) Human 3' UTR Clone
Vector pMirTarget
Synonyms FAG; XRCC9
ACCN NM_004629
Insert Size 299 bp
Sequence Data
>SC203728 3’UTR clone of NM_004629
The sequence shown below is from the reference sequence of NM_004629. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACATCTCTGCCAAAGTCTTGTGACCTGTAGCTGCCACGTTTTGAAGAGCTTGAGCTGGGTCCCCAGTGG
GCTGTCTCTCTGTGGGGAGGGCTTTCTGCTTCACCATCATTAGGAATGTGACCATTCCTATATAATTCC
TGGACTGGTGAGATTGGTGGTAGGCCTGTGAAATTTGCCCTAGTTACTACCATTCTCGTTTTGGAGGAA
ACAATCTCTGCCACCACCAAGTCATTGACTTTGCTCGAGGCACCTTTTTTCCTGTTTCTCCTTTTCTGT
TGTCGAGTAAAATTTCATATTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004629.2
Synonyms FAG; XRCC9
Summary The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group G. [provided by RefSeq, Jul 2008]
Locus ID 2189
MW 11
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...