PLCD1 (NM_001130964) Human 3' UTR Clone

CAT#: SC203724

3' UTR clone of phospholipase C delta 1 (PLCD1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PLCD1 (NM_001130964) Human 3' UTR Clone
Vector pMirTarget
Synonyms NDNC3; PLC-III
ACCN NM_001130964
Insert Size 307 bp
Sequence Data
>SC203724 3’UTR clone of NM_001130964
The sequence shown below is from the reference sequence of NM_001130964. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCTTTGTGAAGATCTCCCTCCAGGACTAGGCTGGAGGAAGCCAGTGGGGTCCCCCCTGAGTGGGCTGG
GCCCTCTGTCCACATGTGGGGACAGGGCTGGTGTGGCTGCTCCCAGCCTCTTGCTCAGAGCTAGGCCCC
CAAATTGCCTTCAGCCCTAACATAGTGTCTGCTGCTGCCTCCCTGGGGACCAGGAGCTAGCCCAGTCCC
TGGAGCTGTCCTTCATTCCGTTAGGAATAACACTGCAGCCCTCTCCACCCTCCGGCCAGCGAGTGGTCA
AGGATTTTTATAAAAATCACGATAAGATTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001130964.2
Synonyms NDNC3; PLC-III
Summary This gene encodes a member of the phospholipase C family. Phospholipase C isozymes play critical roles in intracellular signal transduction by catalyzing the hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) into the second messengers diacylglycerol (DAG) and inositol triphosphate (IP3). The encoded protein functions as a tumor suppressor in several types of cancer, and mutations in this gene are a cause of hereditary leukonychia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Locus ID 5333
MW 11
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...