Nuclear Factor Erythroid Derived 2 (NFE2) (NM_006163) Human 3' UTR Clone

CAT#: SC203634

3' UTR clone of nuclear factor (erythroid-derived 2) 45kDa (NFE2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Nuclear Factor Erythroid Derived 2 (NFE2) (NM_006163) Human 3' UTR Clone
Vector pMirTarget
Synonyms NF-E2; p45
ACCN NM_006163
Insert Size 293 bp
Sequence Data
>SC203634 3’UTR clone of NM_006163
The sequence shown below is from the reference sequence of NM_006163. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGGGGGACCAAGATGGAGGCCACAGACTGAGCTGGCCCAGAGGGGTGGAACTGCTGATGGGATTTCCTT
CATTCCCTTCTGATAAAGGTACTCCCCAACCCTGAGTCCCAGAAGGAGCTGAGTTCTCTAGACCAGAAG
AGGATGACAATGGCAACAAGTGTTTGGAAGTTCCAAGGTGTGTTCAAAGAGGCTTGCCTTGAGGGAGGG
CTGGAATCTGTCTTCCCTGACTCGGCTCCTCAGGTCTTTAGCCTCCACCTTGTCTAAGCTTTGGTCTAT
AAAGTGCGCTACAGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006163.3
Synonyms NF-E2; p45
Summary Component of the NF-E2 complex essential for regulating erythroid and megakaryocytic maturation and differentiation. Binds to the hypersensitive site 2 (HS2) of the beta-globin control region (LCR). This subunit (NFE2) recognizes the TCAT/C sequence of the AP-1-like core palindrome present in a number of erythroid and megakaryocytic gene promoters. Requires MAFK or other small MAF proteins for binding to the NF-E2 motif. May play a role in all aspects of hemoglobin production from globin and heme synthesis to procurement of iron.[UniProtKB/Swiss-Prot Function]
Locus ID 4778
MW 11
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...