CD8B (NM_172102) Human 3' UTR Clone

CAT#: SC203633

3' UTR clone of CD8b molecule (CD8B) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CD8B (NM_172102) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD8B1; LEU2; LY3; LYT3; P37
ACCN NM_172102
Insert Size 268 bp
Sequence Data
>SC203633 3’UTR clone of NM_172102
The sequence shown below is from the reference sequence of NM_172102. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGCTTAACCCATGGATCCTGAAAACATAGGCAAGAAGCACAGGTCCTGATGAGTGGATCTTTACTACT
TTTACCAGATTCCTCCCTCGCTCAGAGGGATCCTCCCACACACCCAGCAGAGACTTCTCTGCCACCATC
AACCCCCCAAGTCATAGGGGGCTCAAGTTCTGCCCTGGTGAGCTGTGGCCCCCATCCTTGTGAACCCCA
AAGTGTCCCCCTTGTGGAACCAAATGTATCCATCTTGAATAAATTTGCCCAAAATCCTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_172102.5
Synonyms CD8B1; LEU2; LY3; LYT3; P37
Summary The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen, acting as a coreceptor, and the T-cell receptor on the T lymphocyte recognize antigens displayed by an antigen presenting cell (APC) in the context of class I MHC molecules. The functional coreceptor is either a homodimer composed of two alpha chains, or a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 beta chain isoforms. Multiple alternatively spliced transcript variants encoding distinct membrane associated or secreted isoforms have been described. A pseudogene, also located on chromosome 2, has been identified. [provided by RefSeq, May 2010]
Locus ID 926
MW 9.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...