HOXD4 (NM_014621) Human 3' UTR Clone

CAT#: SC203602

3' UTR clone of homeobox D4 (HOXD4) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HOXD4 (NM_014621) Human 3' UTR Clone
Vector pMirTarget
Synonyms HHO.C13; Hox-4.2; HOX-5.1; HOX4; HOX4B
ACCN NM_014621
Insert Size 314 bp
Sequence Data
>SC203602 3’UTR clone of NM_014621
The sequence shown below is from the reference sequence of NM_014621. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACCACCACACGGACCTGACGACCTTATAGAAGTGGGGACCCTGGGCCCATCTCTCCCTGCGCACCAGG
CTGAGCCGAAGCTGCGGGGGCAGGCCGGGCCTGCTGTCACCTCGCTGGGCTCTAAGGTACTGTGGGGTG
GACCTGGGACAAGCAGGCCGCCCTCGGACTAGGTTAGCATCCTGCCCGAGGGCAGCCCCCTCCCTAGAG
CGGGATGGGGATGGGAGGGGGGGCGGGATTCTCTCTCTAAGTATATTATATGGCAGGAGCTACTGAGAA
CATAAAATCTTGGCGAGTCATTAAACTTATGAAAATCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014621.3
Synonyms HHO.C13; Hox-4.2; HOX-5.1; HOX4; HOX4B
Summary This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located at 2q31-2q37 chromosome regions. Deletions that removed the entire HOXD gene cluster or 5' end of this cluster have been associated with severe limb and genital abnormalities. The protein encoded by this gene may play a role in determining positional values in developing limb buds. Alternatively spliced variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Locus ID 3233
MW 11.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...