Nucleoside Diphosphate Kinase 7 (NME7) (NM_013330) Human 3' UTR Clone

CAT#: SC203541

3' UTR clone of non-metastatic cells 7 protein expressed in (nucleoside-diphosphate kinase) (NME7) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Nucleoside Diphosphate Kinase 7 (NME7) (NM_013330) Human 3' UTR Clone
Vector pMirTarget
Synonyms CFAP67; MN23H7; NDK 7; NDK7; nm23-H7
ACCN NM_013330
Insert Size 284 bp
Sequence Data
>SC203541 3’UTR clone of NM_013330
The sequence shown below is from the reference sequence of NM_013330. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAATACTTCTTCAAGATCTTGGATAATTAGTGGTGTGGAAAGTAAAGAAGTCACAGGTTGGGACATTTA
GACAAGAGTGAATCACACACGAGGAATGTGTTCATTCTTTTATTGTCCGTTGTTTTAACCTGACTGAAT
ACAAGATCAACAAGAGCACTGTACTCCTGGCAATTATTACATATGTTAGAACATGGATTTTGCACTGTA
GACAACATTTAACACCAGTCTATGGGGTACTGCATTGCTTTTTATAAAGTTCAAAATAAAGATTTATTT
TCAAACAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_013330.5
Synonyms CFAP67; MN23H7; NDK 7; NDK7; nm23-H7
Summary This gene encodes a member of the non-metastatic expressed family of nucleoside diphosphate kinases. Members of this family are enzymes that catalyzes phosphate transfer from nucleoside triphosphates to nucleoside diphosphates. This protein contains two kinase domains, one of which is involved in autophosphorylation and the other may be inactive. This protein localizes to the centrosome and functions as a component of the gamma-tubulin ring complex which plays a role in microtubule organization. Mutations in this gene may be associated with venous thromboembolism. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Locus ID 29922
MW 11.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...