RPS27A (NM_001135592) Human 3' UTR Clone

CAT#: SC203534

3' UTR clone of ribosomal protein S27a (RPS27A) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RPS27A (NM_001135592) Human 3' UTR Clone
Vector pMirTarget
Synonyms CEP80; HEL112; S27A; UBA80; UBC; UBCEP1; UBCEP80
ACCN NM_001135592
Insert Size 306 bp
Sequence Data
>SC203534 3’UTR clone of NM_001135592
The sequence shown below is from the reference sequence of NM_001135592. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACTGTTTCAACAAACCAGAAGACAAGTAACTGTATGAGTTAATAAAAGACATGAACTAACATTTATTG
TTGGGTTTTATTGCAGTAAAAAGAATGGTTTTTAAGCACCAAATTGATGGTCACACCATTTCCTTTTAG
TAGTGCTACTGCTATCGCTGTGTGAATGTTGCCTCTGGGGATTATGTGACCCAGTGGTTCTGTATACCT
GCCAGGTGCCAACCACTTGTAAAGGTCTTGATATTTTCAATTCTTAGACTACCTATACTTTGGCAGAAG
TTATATTTAATGTAAGTTGTCTAAATATAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001135592.2
Synonyms CEP80; HEL112; S27A; UBA80; UBC; UBCEP1; UBCEP80
Summary Ubiquitin, a highly conserved protein that has a major role in targeting cellular proteins for degradation by the 26S proteosome, is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin fused to an unrelated protein. This gene encodes a fusion protein consisting of ubiquitin at the N terminus and ribosomal protein S27a at the C terminus. When expressed in yeast, the protein is post-translationally processed, generating free ubiquitin monomer and ribosomal protein S27a. Ribosomal protein S27a is a component of the 40S subunit of the ribosome and belongs to the S27AE family of ribosomal proteins. It contains C4-type zinc finger domains and is located in the cytoplasm. Pseudogenes derived from this gene are present in the genome. As with ribosomal protein S27a, ribosomal protein L40 is also synthesized as a fusion protein with ubiquitin; similarly, ribosomal protein S30 is synthesized as a fusion protein with the ubiquitin-like protein fubi. Multiple alternatively spliced transcript variants that encode the same proteins have been identified.[provided by RefSeq, Sep 2008]
Locus ID 6233
MW 12
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...