CLIC1 (NM_001288) Human 3' UTR Clone

CAT#: SC203520

3' UTR clone of chloride intracellular channel 1 (CLIC1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CLIC1 (NM_001288) Human 3' UTR Clone
Vector pMirTarget
Synonyms CL1C1; CLCNL1; G6; NCC27
ACCN NM_001288
Insert Size 273 bp
Sequence Data
>SC203520 3’UTR clone of NM_001288
The sequence shown below is from the reference sequence of NM_001288. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TATGAGCAAGTGGCAAAGGCCCTCAAATAAGCCCCTCCTGGGACTCCCTCAACCCCCTCCATTTTCTCC
ACAAAGGCCCTGGTGGTTTCCACATTGCTACCCAATGGACACACTCCAAAATGGCCAGTGGGCAGGGAA
TCCTGGAGCACTTGTTCCGGGATGGTGTGGTGGAAGAGGGGATGAGGGAAAGAAATGGGGGGCCTGGGT
CAGATTTTTATTGTGGGGTGGGATGAGTAGGACAACATATTTCAGTAATAAAATACAGAATAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001288.6
Synonyms CL1C1; CLCNL1; G6; NCC27
Summary Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 1 is a member of the p64 family; the protein localizes principally to the cell nucleus and exhibits both nuclear and plasma membrane chloride ion channel activity. [provided by RefSeq, Jul 2008]
Locus ID 1192
MW 10
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...