Protein Z (PROZ) (NM_003891) Human 3' UTR Clone

CAT#: SC203506

3' UTR clone of protein Z vitamin K-dependent plasma glycoprotein (PROZ) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Protein Z (PROZ) (NM_003891) Human 3' UTR Clone
Vector pMirTarget
Synonyms PZ
ACCN NM_003891
Insert Size 311 bp
Sequence Data
>SC203506 3’UTR clone of NM_003891
The sequence shown below is from the reference sequence of NM_003891. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCACTCTGGTTTAAACAGATCATGAACTAACTGAAACTCAGCTAGCCAGAATGAACAACACAACCGGAA
GCGGGATTCCAAGCTGGCACTGCCACTGTGGAGGGCGCTGAAACTTCATCACACACTGAGAGGCCGTCA
CAGCCCCAGACCACCCGCTTGGCCCACGCAGCAGCAGAGCCGCCGTTTGCTGGGTTGTTTACCGAGCAC
TGTGACCTTTCTTTCCCTGGAACTCTTTATCTCAATAGAGACCTTAAAAGAAAACATGAGATACGTTAA
ATAATAAAATAAGATAATCTGTCAGTCATAAAGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003891.3
Synonyms PZ
Summary This gene encodes a liver vitamin K-dependent glycoprotein that is synthesized in the liver and secreted into the plasma. The encoded protein plays a role in regulating blood coagulation by complexing with protein Z-dependent protease inhibitor to directly inhibit activated factor X at the phospholipid surface. Deficiencies in this protein are associated with an increased risk of ischemic arterial diseases and fetal loss. Mutations in this gene are the cause of protein Z deficiency. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Locus ID 8858
MW 11.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...