ASS1 (NM_000050) Human 3' UTR Clone

CAT#: SC203378

3' UTR clone of argininosuccinate synthetase 1 (ASS1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ASS1 (NM_000050) Human 3' UTR Clone
Vector pMirTarget
Synonyms ASS; CTLN1
ACCN NM_000050
Insert Size 298 bp
Sequence Data
>SC203378 3’UTR clone of NM_000050
The sequence shown below is from the reference sequence of NM_000050. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGTCTCCAGAGCAAGGTCACTGCCAAATAGACCCGTGTACAATGAGGAGCTGGGGCCTCCTCAATTTGC
AGATCCCCCAAGTACAGGCGCTAATTGTTGTGATAATTTGTAATTGTGACTTGTTCTCCCCGGCTGGCA
GCGTAGTGGGGCTGCCAGGCCCCAGCTTTGTTCCCTGGTCCCCCTGAAGCCTGCAAACGTTGTCATCGA
AGGGAAGGGTGGGGGGCAGCTGCGGTGGGGAGCTATAAAAATGACAATTAAAAGAGACACTAGTCTTTT
ATTTCTAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000050.4
Synonyms ASS; CTLN1
Summary The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromosome 9 appears to be the only functional gene for argininosuccinate synthetase. Mutations in the chromosome 9 copy of this gene cause citrullinemia. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2012]
Locus ID 445
MW 11
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...