DPM1 (NM_003859) Human 3' UTR Clone

CAT#: SC203320

3' UTR clone of dolichyl-phosphate mannosyltransferase polypeptide 1 catalytic subunit (DPM1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DPM1 (NM_003859) Human 3' UTR Clone
Vector pMirTarget
Synonyms CDGIE; MPDS
ACCN NM_003859
Insert Size 292 bp
Sequence Data
>SC203320 3’UTR clone of NM_003859
The sequence shown below is from the reference sequence of NM_003859. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGATTATTGACTCTTTTTGCTACTACATAAAAGAAAGATACTCATTTATAGTTACGTTCATTTCAGGTT
AAACATGAAAGAAGCCTGGTTACTGATTTGTATAAAATGTACTCTTAAAGTATAAAATATAAGGTAAGG
TAAATTTCATGCATCTTTTTATGAAGACCACCTATTTTATATTTCAAATTAAATAATTTTAAAGTTGCT
GGCCTAATGAGCAATGTTCTCAATTTTCGTTTTCATTTTGCTGTATTGAGACCTATAAATAAATGTATA
TTTTTTTTTGCATAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003859.3
Synonyms CDGIE; MPDS
Summary Dolichol-phosphate mannose (Dol-P-Man) serves as a donor of mannosyl residues on the lumenal side of the endoplasmic reticulum (ER). Lack of Dol-P-Man results in defective surface expression of GPI-anchored proteins. Dol-P-Man is synthesized from GDP-mannose and dolichol-phosphate on the cytosolic side of the ER by the enzyme dolichyl-phosphate mannosyltransferase. Human DPM1 lacks a carboxy-terminal transmembrane domain and signal sequence and is regulated by DPM2. Mutations in this gene are associated with congenital disorder of glycosylation type Ie. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Locus ID 8813
MW 11.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...