DDX19B (NM_001014449) Human 3' UTR Clone

CAT#: SC203293

3' UTR clone of DEAD (Asp-Glu-Ala-As) box polypeptide 19B (DDX19B) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DDX19B (NM_001014449) Human 3' UTR Clone
Vector pMirTarget
Synonyms DBP5; DDX19; RNAh
ACCN NM_001014449
Insert Size 261 bp
Sequence Data
>SC203293 3' UTR clone of NM_001014449
The sequence shown below is from the reference sequence of NM_001014449. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGACACAGATGATTTGGACGAGATTGAGAAAATAGCCAACTGAGAAGCTCCACCAGCCACTGATGCCAGC
CCTGGCACTGCCCCTGCACAGGAGACAAGTGCGTTCAGGGCACAGGCCCCGACATCACCCCAAGGACAAC
GGCACAAGTAGAGAGAAACTACCTACCTCACTTCAAATTATGTTTGGACTTGACAAAAATGTATGCAAAT
GATGGGGGATGGTAGAAAAAAATTATTTACACAACCTTGGAAGATTAGGCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001014449.1
Synonyms DBP5; DDX19; RNAh
Summary DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which exhibits RNA-dependent ATPase and ATP-dependent RNA-unwinding activities. This protein is recruited to the cytoplasmic fibrils of the nuclear pore complex, where it participates in the export of mRNA from the nucleus. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 11269
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...