EHMT1/GLP (EHMT1) (NM_001145527) Human 3' UTR Clone

CAT#: SC203263

3' UTR clone of euchromatic histone-lysine N-methyltransferase 1 (EHMT1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name EHMT1/GLP (EHMT1) (NM_001145527) Human 3' UTR Clone
Vector pMirTarget
Synonyms EHMT1-IT1; Eu-HMTase1; EUHMTASE1; FP13812; GLP; GLP1; KLEFS1; KMT1D
ACCN NM_001145527
Insert Size 273 bp
Sequence Data
>SC203263 3’UTR clone of NM_001145527
The sequence shown below is from the reference sequence of NM_001145527. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGCCCAAGGTCGAGGGGCTGCCTTTGGTGACTTATGGTGAGGACCTCGTGCTGTTCCCGAACACAGCCA
GGAACCACGCCAAGAGGAAGATGCTCCAGCACAGCCTTGCTGTGGACCAGGCCGCCCACAGGGAGCAGG
TCCATTCCTGGGGGCTGACTCCGCCTTTCAGAGAGGCGTGGCTCCATCTTCACAGCCTCGTAGCCTCTT
AAAGGCCCAGCCTCAAAACCTCATTGGGGCCCCCAGCCCCGGTAAATAAATTGCATTCAGACCATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001145527.2
Synonyms EHMT1-IT1; Eu-HMTase1; EUHMTASE1; FP13812; GLP; GLP1; KLEFS1; KMT1D
Summary The protein encoded by this gene is a histone methyltransferase that methylates the lysine-9 position of histone H3. This action marks the genomic region packaged with these methylated histones for transcriptional repression. This protein may be involved in the silencing of MYC- and E2F-responsive genes and therefore could play a role in the G0/G1 cell cycle transition. Defects in this gene are a cause of chromosome 9q subtelomeric deletion syndrome (9q-syndrome, also known as Kleefstra syndrome). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2017]
Locus ID 79813
MW 9.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...