UGT2B28 (NM_053039) Human 3' UTR Clone

CAT#: SC203244

3' UTR clone of UDP glucuronosyltransferase 2 family polypeptide B28 (UGT2B28) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name UGT2B28 (NM_053039) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_053039
Insert Size 271 bp
Sequence Data
>SC203244 3’UTR clone of NM_053039
The sequence shown below is from the reference sequence of NM_053039. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGAAAAGGGAAGAAGGGAAAAAGAGATTAGTTATGTCTGACATTTGAAGCTGGAAAACCAGATAGATGG
GTTGACATCAGTTTATTCCAGCAAGAAAGAAAAGATTGTTATGCAAGATTTCTTTCTTCCTGTGACAAA
AAAAAAAACTTTTCAAAATCTACCTTGTCAAGTAAAAATTTGTTTTTCAGAGATTTACCACCCAGGTAA
TGGTTAGAAATATTCTGTGGCAATGAAGAAAACACTAGGGAAAATAAAAAATAATATAAAGCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_053039.2
Summary This gene encodes a member of the uridine diphosphoglucuronosyltransferase protein family. The encoded enzyme catalyzes the transfer of glucuronic acid from uridine diphosphoglucuronic acid to a diverse array of substrates including steroid hormones and lipid-soluble drugs. This process, known as glucuronidation, is an intermediate step in the metabolism of steroids. Two transcript variants encoding different isoforms have been found for this gene. While both isoforms are targeted to the endoplasmic reticulum, only the longer isoform appears to be active. [provided by RefSeq, May 2011]
Locus ID 54490
MW 10.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...