Thyroid Peroxidase (TPO) (NM_175721) Human 3' UTR Clone

CAT#: SC203237

3' UTR clone of thyroid peroxidase (TPO) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Thyroid Peroxidase (TPO) (NM_175721) Human 3' UTR Clone
Vector pMirTarget
Synonyms MSA; TDH2A; TPX
ACCN NM_175721
Insert Size 289 bp
Sequence Data
>SC203237 3’UTR clone of NM_175721
The sequence shown below is from the reference sequence of NM_175721. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATACTCACAGGCTGCCGAGAGCCCTCTGAGGGCAAAGTGGCAGGACACTGCAGAACAGCTTCATGTTC
CCAAAATCACCGTACGACTCTTTTCCAAACACAGGCAAATCCGAAATCAGCAGGACGACTGTTTTCCCA
ACACGGGTAAATCTAGTACCATGTCGTAGTTACTCTCAGGCATGGATGAATAAATGTTATAGCTGCATT
TGTCTGGCCTTTTCTTGTAAACATTGCCTGATTTGTTCCTTCTGGGGCTTTGCCATTAAAATGTATTTA
CAGATTAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_175721.3
Synonyms MSA; TDH2A; TPX
Summary This gene encodes a membrane-bound glycoprotein. The encoded protein acts as an enzyme and plays a central role in thyroid gland function. The protein functions in the iodination of tyrosine residues in thyroglobulin and phenoxy-ester formation between pairs of iodinated tyrosines to generate the thyroid hormones, thyroxine and triiodothyronine. Mutations in this gene are associated with several disorders of thyroid hormonogenesis, including congenital hypothyroidism, congenital goiter, and thyroid hormone organification defect IIA. Multiple transcript variants encoding distinct isoforms have been identified for this gene, but the full-length nature of some variants has not been determined. [provided by RefSeq, May 2011]
Locus ID 7173
MW 11.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...