HNF 4 alpha (HNF4A) (NM_178850) Human 3' UTR Clone

CAT#: SC203188

3' UTR clone of hepatocyte nuclear factor 4 alpha (HNF4A) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HNF 4 alpha (HNF4A) (NM_178850) Human 3' UTR Clone
Vector pMirTarget
Synonyms FRTS4; HNF4; HNF4a7; HNF4a8; HNF4a9; HNF4alpha; MODY; MODY1; NR2A1; NR2A21; TCF; TCF-14; TCF14
ACCN NM_178850
Insert Size 294 bp
Sequence Data
>SC203188 3’UTR clone of NM_178850
The sequence shown below is from the reference sequence of NM_178850. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCACTGTGCCGCTTTGGGCAAGTTGCTTAACCTGTCTGTGCCTCAGTTTCCTCACCAGAAAAATGGGAA
CAAGGCAATGGTCTATTTGTTCAGGCACCGAGAACCTAGCACGTGCCAGTCACTGTTCTAAGTGCTGGC
AATTCAGCAAAGAACAAGATCTTTGCCCTCGGGGAGGCTGTGTGTGTGTGAGTATGTATGGATGCGTGG
ATATCTGTGTATATGCCCGTATGTGCGTGCATGTGTATATAAAGCCTCACATTTTATGATTTTGAAATA
AACAGGTAATATGATAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_178850.3
Synonyms FRTS4; HNF4; HNF4a7; HNF4a8; HNF4a9; HNF4alpha; MODY; MODY1; NR2A1; NR2A21; TCF; TCF-14; TCF14
Summary The protein encoded by this gene is a nuclear transcription factor which binds DNA as a homodimer. The encoded protein controls the expression of several genes, including hepatocyte nuclear factor 1 alpha, a transcription factor which regulates the expression of several hepatic genes. This gene may play a role in development of the liver, kidney, and intestines. Mutations in this gene have been associated with monogenic autosomal dominant non-insulin-dependent diabetes mellitus type I. Alternative splicing of this gene results in multiple transcript variants encoding several different isoforms. [provided by RefSeq, Apr 2012]
Locus ID 3172
MW 10.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...