TRPM3 (NM_001007470) Human 3' UTR Clone

CAT#: SC203168

3' UTR clone of transient receptor potential cation channel subfamily M member 3 (TRPM3) transcript variant 8 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TRPM3 (NM_001007470) Human 3' UTR Clone
Vector pMirTarget
Synonyms GON-2; LTRPC3; MLSN2
ACCN NM_001007470
Insert Size 271 bp
Sequence Data
>SC203168 3’UTR clone of NM_001007470
The sequence shown below is from the reference sequence of NM_001007470. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGCATAAATACTCAGAAGAAGGCGGGTAGGTAACTTTCCAGGCCCCATGGAAGAACCCTAAAGCCTGT
TTGGAAACGAGGGTATGAGTGGATTATGTTTTCAGTAGCTCAACCAAGACCTCAAATCAAAACAAGCTA
TGAACAAATTGTCTAAAAAATGTCTGTCATGGGAGGGCTGTGGTGAAGAACAGAGAAACATATTCTAAA
TGTCCTGTGAAGTGGGAAATTCTATGAAAGCTACACGGATAATAAAAAGGGTGAGGAAAAGAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001007470.3
Synonyms GON-2; LTRPC3; MLSN2
Summary The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Locus ID 80036
MW 10.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...