ASC1 (TRIP4) (NM_016213) Human 3' UTR Clone

CAT#: SC203164

3' UTR clone of thyroid hormone receptor interactor 4 (TRIP4) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ASC1 (TRIP4) (NM_016213) Human 3' UTR Clone
Vector pMirTarget
Synonyms ASC-1; ASC1; HsT17391; MDCDC; SMABF1; ZC2HC5
ACCN NM_016213
Insert Size 269 bp
Sequence Data
>SC203164 3’UTR clone of NM_016213
The sequence shown below is from the reference sequence of NM_016213. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGTTAATGAAGCAGAATAAAGCTGTCTGACCCAGGAGAAAAGGAACTATACAGCATAGTGGAGTTTTG
TGTACTAAAATTGCTATCTACTGGTCCTTTGGAATTGAAGTAGTAGAAACCTAAAGGCTTGGCGTCAGG
CTTGAATATCTCAGAACTTAAACTCTTACCAAAATCTGTATATTTTTCTTAAGGAGTGGGATTCCTACT
TTATGTAATGGGGTCGAAATCTTTGAACACATTATTTATAAAAACCTGTTTAAAAATTCTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016213.5
Synonyms ASC-1; ASC1; HsT17391; MDCDC; SMABF1; ZC2HC5
Summary This gene encodes a subunit of the tetrameric nuclear activating signal cointegrator 1 (ASC-1) complex, which associates with transcriptional coactivators, nuclear receptors and basal transcription factors to facilitate nuclear receptors-mediated transcription. This protein is localized in the nucleus and contains an E1A-type zinc finger domain, which mediates interaction with transcriptional coactivators and ligand-bound nuclear receptors, such as thyroid hormone receptor and retinoid X receptor alpha, but not glucocorticoid receptor. Mutations in this gene are associated with spinal muscular atrophy with congenital bone fractures-1 (SMABF1). [provided by RefSeq, Apr 2016]
Locus ID 9325
MW 10.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...