Cystatin S (CST4) (NM_001899) Human 3' UTR Clone

CAT#: SC203150

3' UTR clone of cystatin S (CST4) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Cystatin S (CST4) (NM_001899) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_001899
Insert Size 284 bp
Sequence Data
>SC203150 3’UTR clone of NM_001899
The sequence shown below is from the reference sequence of NM_001899. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGTGAATTCCAGGTGTCAAGAAGCCTAGGGGTCTGTGCCAGGCCAGTCACACCGACCACCACCCACT
CCCACCCACTGTAGTGCTCCCACCCCTGGACTGGTGGCCCCCACCCTGCGGGAGGCCTCCCCATGTGCC
TGTGCCAAGAGACAGACAGAGAAGGCTGCAGGAGTCCTTTGTTGCTCAGCAGGGCGCTCTGCCCTCCCT
CCTTCCTTCTTGCTTCTAATAGACCTGGTACATGGTACACACACCCCCACCTCCTGCAATTAAACAGTA
GCATCGCC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001899.3
Summary The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a type 2 salivary cysteine peptidase inhibitor. The protein is an S-type cystatin, based on its high level of expression in saliva, tears and seminal plasma. The specific role in these fluids is unclear but antibacterial and antiviral activity is present, consistent with a protective function. [provided by RefSeq, Jul 2008]
Locus ID 1472
MW 9.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...