CIP29 (SARNP) (NM_033082) Human 3' UTR Clone

CAT#: SC203133

3' UTR clone of SAP domain containing ribonucleoprotein (SARNP) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CIP29 (SARNP) (NM_033082) Human 3' UTR Clone
Vector pMirTarget
Synonyms CIP29; HCC1; HSPC316; THO1
ACCN NM_033082
Insert Size 272 bp
Sequence Data
>SC203133 3’UTR clone of NM_033082
The sequence shown below is from the reference sequence of NM_033082. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAAAGAGCAGAGCGCTTTGGGATTGCCTGATGAAAAGTTCCTGATACTTTCTGTTCTCCAGTGTTTTCC
ATTTCTCTCCTTCTTCTTGGTCACATATATGCCTAAATGCACAGTCATGTGCCTACGTCCTGCCTCGCA
ATGAGGGAGCATGTACCCCAGGTACATCCATGAACTGCGGCAGCAGTTTGACTTATTGCTGTTTCAGCT
TTAAGGTTGTTGTGTTTTTGTTTTTGATTATGTTGCTTGTTAATAAAAAAAAATAGAAAAGAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_033082.4
Synonyms CIP29; HCC1; HSPC316; THO1
Summary This gene encodes a protein that is upregulated in response to various cytokines. The encoded protein may play a role in cell cycle progression. A translocation between this gene and the myeloid/lymphoid leukemia gene, resulting in expression of a chimeric protein, has been associated with acute myelomonocytic leukemia. Pseudogenes exist on chromosomes 7 and 8. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Locus ID 84324
MW 10
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...