Asialoglycoprotein Receptor 2 (ASGR2) (NM_001181) Human 3' UTR Clone

CAT#: SC203125

3' UTR clone of asialoglycoprotein receptor 2 (ASGR2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Asialoglycoprotein Receptor 2 (ASGR2) (NM_001181) Human 3' UTR Clone
Vector pMirTarget
Synonyms ASGP-R2; ASGPR2; CLEC4H2; HBXBP; HL-2
ACCN NM_001181
Insert Size 283 bp
Sequence Data
>SC203125 3’UTR clone of NM_001181
The sequence shown below is from the reference sequence of NM_001181. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGGCGGAATGCCACCGGCGAGGTGGCCTGACCCCAGCACACCTCTGGCTAACCCATACCCCACACCTGC
CCAGCTCTGGCTTCTCTGTTGAGGATTTTGAGGAAAGGAAGAAACACTGAGACAGGGGTATGGGGAAGA
GCTGAGCAAAGAGAGAAAGGAGGTAGTTTAAGAGTCCCTGACCCTGGAGGACTGAGATCCCACCTCCTT
CTGTAATTCATTGTAATTATTATAATCGTCAGCCTCTTCAATGGCGTAGGAAAGAAGAAACAAATGCTT
GAATCTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001181.4
Synonyms ASGP-R2; ASGPR2; CLEC4H2; HBXBP; HL-2
Summary This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Locus ID 433
MW 10.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...