AHA1 (AHSA1) (NM_012111) Human 3' UTR Clone

CAT#: SC203113

3' UTR clone of AHA1 activator of heat shock 90kDa protein ATPase homolog 1 (yeast) (AHSA1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name AHA1 (AHSA1) (NM_012111) Human 3' UTR Clone
Vector pMirTarget
Synonyms AHA1; C14orf3; hAha1; p38
ACCN NM_012111
Insert Size 253 bp
Sequence Data
>SC203113 3’UTR clone of NM_012111
The sequence shown below is from the reference sequence of NM_012111. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCTTTGGCTATGGCGCACGCTTATTTTAGGGCCAGCGGCAGGGGACTCCAGCCTGCTGGACACTTCAG
TCCAGCTCTCTCCTGACTGGGGCTTGCGACTCACAGGATTGCATCGTCCCAGCTGCTAACTTGGGGCCG
GGGCCCCTCCCTTCCACATATACCTTGGGTTTGTGCATGTTTTCTGCTGGGTGGGTTCAGAGGGCAATT
TCTCTTTTATGTGTACATATGCTAAATAAACATAATTTAAAAAACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_012111.3
Synonyms AHA1; C14orf3; hAha1; p38
Summary Acts as a co-chaperone of HSP90AA1 (PubMed:29127155). Activates the ATPase activity of HSP90AA1 leading to increase in its chaperone activity (PubMed:29127155). Competes with the inhibitory co-chaperone FNIP1 for binding to HSP90AA1, thereby providing a reciprocal regulatory mechanism for chaperoning of client proteins (PubMed:27353360). Competes with the inhibitory co-chaperone TSC1 for binding to HSP90AA1, thereby providing a reciprocal regulatory mechanism for chaperoning of client proteins (PubMed:29127155).[UniProtKB/Swiss-Prot Function]
Locus ID 10598
MW 9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...