DCTN3 (NM_007234) Human 3' UTR Clone

CAT#: SC203076

3' UTR clone of dynactin 3 (p22) (DCTN3) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DCTN3 (NM_007234) Human 3' UTR Clone
Vector pMirTarget
Synonyms DCTN-22; DCTN22
ACCN NM_007234
Insert Size 266 bp
Sequence Data
>SC203076 3’UTR clone of NM_007234
The sequence shown below is from the reference sequence of NM_007234. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCACGCAAGTGAAGCCAGCAGAGGAGTGATAGCTGCTCCCCATCCCAAAGTGGGCCTGGGCAGTCAGG
CTCCAGGGCCCTATGCCAACCTGCCTTTGTTACAAGGCAGAGGAAGCTTTGTATTTATTGGCTTCAAGG
CCCACCTCTCTGTACTCTGGGCTCTAAAGTTGGAGGTCAGGTTACCTGAGGTTTGCAATTTGCAACACC
CACCCTCCCCCCAATCAGTGTTCTTATTTCAGTGACAATAAACCATAGAGATGACTGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_007234.5
Synonyms DCTN-22; DCTN22
Summary This gene encodes the smallest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, cytokinesis, chromosome movement, nuclear positioning, and axonogenesis. This subunit, like most other dynactin subunits, exists only as a part of the dynactin complex. It is primarily an alpha-helical protein with very little coiled coil, and binds directly to the largest subunit (p150) of dynactin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Locus ID 11258
MW 10
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...