Macrophage Inflammatory Protein 3 beta (CCL19) (NM_006274) Human 3' UTR Clone

CAT#: SC203050

3' UTR clone of chemokine (C-C motif) ligand 19 (CCL19) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Macrophage Inflammatory Protein 3 beta (CCL19) (NM_006274) Human 3' UTR Clone
Vector pMirTarget
Synonyms CKb11; ELC; MIP-3b; MIP3B; SCYA19
ACCN NM_006274
Insert Size 279 bp
Sequence Data
>SC203050 3’UTR clone of NM_006274
The sequence shown below is from the reference sequence of NM_006274. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCAGCCAAGATGAAGCGCCGCAGCAGTTAACCTATGACCGTGCAGAGGGAGCCCGGAGTCCGAGTCAAG
CATTGTGAATTATTACCTAACCTGGGGAACCGAGGACCAGAAGGAAGGACCAGGCTTCCAGCTCCTCTG
CACCAGACCTGACCAGCCAGGACAGGGCCTGGGGTGTGTGTGAGTGTGAGTGTGAGCGAGAGGGTGAGT
GTGGTCAGAGTAAAGCTGCTCCACCCCCAGATTGCAATGCTACCAATAAAGCCGCCTGGTGTTTACAAC
TAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006274.3
Synonyms CKb11; ELC; MIP-3b; MIP3B; SCYA19
Summary This antimicrobial gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene may play a role in normal lymphocyte recirculation and homing. It also plays an important role in trafficking of T cells in thymus, and in T cell and B cell migration to secondary lymphoid organs. It specifically binds to chemokine receptor CCR7. [provided by RefSeq, Sep 2014]
Locus ID 6363
MW 10.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...