TPM1 (NM_000366) Human 3' UTR Clone

CAT#: SC203049

3' UTR clone of tropomyosin 1 (alpha) (TPM1) transcript variant 5 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TPM1 (NM_000366) Human 3' UTR Clone
Vector pMirTarget
Synonyms C15orf13; CMD1Y; CMH3; HEL-S-265; HTM-alpha; LVNC9; TMSA
ACCN NM_000366
Insert Size 357 bp
Sequence Data
>SC203049 3’UTR clone of NM_000366
The sequence shown below is from the reference sequence of NM_000366. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACGCTCTCAACGATATGACTTCCATGTAAACGTTCATCCACTCTGCCTGCTTACACCCTGCCCTCATG
CTAATATAAGTTTCTTTGCTTCACTTCTCCCAAGACTCCCTCGTCGAGCTGGATGTCCCACCTCTCTGA
GCTCTGCATTTGTCTATTCTCCAGCTGACCCTGGTTCTCTCTCTTAGCATCCTGCCTTAGAGCCAGGCA
CACACTGTGCTTTCTATTGTACAGAAGCTCTTCGTTTCAGTGTCAAATAAACACTGTGTAAGCTATTTC
TGTTTGCTATTCTTTTTACTTCTTATTTATTGACATTTTAGTTTCAACATTGAATAAAACTACAAAGCT
GCTTCACACATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000366.6
Synonyms C15orf13; CMD1Y; CMH3; HEL-S-265; HTM-alpha; LVNC9; TMSA
Summary This gene is a member of the tropomyosin family of highly conserved, widely distributed actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosin is composed of two alpha-helical chains arranged as a coiled-coil. It is polymerized end to end along the two grooves of actin filaments and provides stability to the filaments. The encoded protein is one type of alpha helical chain that forms the predominant tropomyosin of striated muscle, where it also functions in association with the troponin complex to regulate the calcium-dependent interaction of actin and myosin during muscle contraction. In smooth muscle and non-muscle cells, alternatively spliced transcript variants encoding a range of isoforms have been described. Mutations in this gene are associated with type 3 familial hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
Locus ID 7168
MW 13.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...