PIGB (NM_004855) Human 3' UTR Clone

CAT#: SC203027

3' UTR clone of phosphatidylinositol glycan anchor biosynthesis class B (PIGB) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PIGB (NM_004855) Human 3' UTR Clone
Vector pMirTarget
Synonyms DEE80; EIEE80; GPI-MT-III; PIG-B
ACCN NM_004855
Insert Size 246 bp
Sequence Data
>SC203027 3’UTR clone of NM_004855
The sequence shown below is from the reference sequence of NM_004855. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGAAATTCAACATGAAGATGAAATTCTGAACTTTCCTAGATAAATTAACATTGCTGGGTGGAAATATT
CAGATGCTGCTTAAATACTTCGGTAAACACTGGGTAAGATTCATGGAACTTAGAAAAAAGCTGTATGAA
CTGCTTTACCAAATATCACTACTGAGGAAATGTATAAAATACCACATAGTATAAAATTACATGTTAATA
CAATGCCAGATTTTAAATAAAGACCTTTAGTTTTCCTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004855.5
Synonyms DEE80; EIEE80; GPI-MT-III; PIG-B
Summary This gene encodes a transmembrane protein that is located in the endoplasmic reticulum and is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene is thought to encode a member of a family of dolichol-phosphate-mannose (Dol-P-Man) dependent mannosyltransferases. [provided by RefSeq, Jul 2008]
Locus ID 9488
MW 10
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...