MMP9 (NM_004994) Human 3' UTR Clone

CAT#: SC202997

3' UTR clone of matrix metallopeptidase 9 (gelatinase B 92kDa gelatinase 92kDa type IV collagenase) (MMP9) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MMP9 (NM_004994) Human 3' UTR Clone
Vector pMirTarget
Synonyms CLG4B; GELB; MANDP2; MMP-9
ACCN NM_004994
Insert Size 223 bp
Sequence Data
>SC202997 3’UTR clone of NM_004994
The sequence shown below is from the reference sequence of NM_004994. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TATGACATCCTGCAGTGCCCTGAGGACTAGGGCTCCCGTCCTGCTTTGGCAGTGCCATGTAAATCCCCA
CTGGGACCAACCCTGGGGAAGGAGCCAGTTTGCCGGATACAAACTGGTATTCTGTTCTGGAGGAAAGGG
AGGAGTGGAGGTGGGCTGGGCCCTCTCTTCTCACCTTTGTTTTTTGTTGGAGTGTTTCTAATAAACTTG
GATTCTCTAACCTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004994.3
Synonyms CLG4B; GELB; MANDP2; MMP-9
Summary Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. The enzyme encoded by this gene degrades type IV and V collagens. Studies in rhesus monkeys suggest that the enzyme is involved in IL-8-induced mobilization of hematopoietic progenitor cells from bone marrow, and murine studies suggest a role in tumor-associated tissue remodeling. [provided by RefSeq, Jul 2008]
Locus ID 4318
MW 8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...