ZGPAT (NM_032527) Human 3' UTR Clone

CAT#: SC202962

3' UTR clone of zinc finger CCCH-type with G patch domain (ZGPAT) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ZGPAT (NM_032527) Human 3' UTR Clone
Vector pMirTarget
Synonyms GPATC6; GPATCH6; KIAA1847; ZC3H9; ZC3HDC9; ZIP
ACCN NM_032527
Insert Size 253 bp
Sequence Data
>SC202962 3’UTR clone of NM_032527
The sequence shown below is from the reference sequence of NM_032527. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACACCCACAAGAAGATGACTGAGTTCTAGAGACCCCACAAGCACTATGGACGAAGCGTGGGACCCCAG
CACGGGCTGCCCTCAGGAAGACCAGTGTTGCCCGAGGAGGGGCCGGCCTGCTGGCCTGGGGCGTGCAGA
CACTGCTGAGTGGAGACAGAGCTGCGGGGTCCCATCTGGACACTTACTTGCCCACCTGCCAGTGTCTTG
GGCATTTCCTTGGCAAGGACATTAAAGTGATTTCATCACAGTGTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032527.5
Synonyms GPATC6; GPATCH6; KIAA1847; ZC3H9; ZC3HDC9; ZIP
Summary Transcription repressor that specifically binds the 5'-GGAG[GA]A[GA]A-3' consensus sequence. Represses transcription by recruiting the chromatin multiprotein complex NuRD to target promoters. Negatively regulates expression of EGFR, a gene involved in cell proliferation, survival and migration. Its ability to repress genes of the EGFR pathway suggest it may act as a tumor suppressor. Able to suppress breast carcinogenesis.[UniProtKB/Swiss-Prot Function]
Locus ID 84619
MW 9.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...