HRH2 (NM_022304) Human 3' UTR Clone

CAT#: SC202946

3' UTR clone of histamine receptor H2 (HRH2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HRH2 (NM_022304) Human 3' UTR Clone
Vector pMirTarget
Synonyms H2R
ACCN NM_022304
Insert Size 272 bp
Sequence Data
>SC202946 3’UTR clone of NM_022304
The sequence shown below is from the reference sequence of NM_022304. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACGGCCCCCCAGGGAGCCACAGACAGGTAATAGCCCTAGCCATTGGTGCACAGGATGGGGGCAATGGGA
GGGGATGCTACTGATGGGAATGATTAAGGGAGCTGCTGTTTAGGTGGTGCTGGTTTATGTTCTAGGAAC
TCTTCATGAGCACTTTGTAAACACCCTCTTGCTTAATCCTCCCAACGGCCCCCAAAGGTAGAACTTAGC
TCCCTTTTAAAAGGAGCACATTAAAATTCTCAGAGGACTTGGCAAGGGCCGCACAGCTGGGGCCT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_022304.2
Synonyms H2R
Summary Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. Histamine receptor H2 belongs to the family 1 of G protein-coupled receptors. It is an integral membrane protein and stimulates gastric acid secretion. It also regulates gastrointestinal motility and intestinal secretion and is thought to be involved in regulating cell growth and differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Locus ID 3274
MW 9.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...