alpha Sarcoglycan (SGCA) (NM_000023) Human 3' UTR Clone

CAT#: SC202925

3' UTR clone of sarcoglycan alpha (50kDa dystrophin-associated glycoprotein) (SGCA) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name alpha Sarcoglycan (SGCA) (NM_000023) Human 3' UTR Clone
Vector pMirTarget
Synonyms 50DAG; adhalin; ADL; DAG2; DMDA2; LGMD2D; LGMDR3; SCARMD1
ACCN NM_000023
Insert Size 259 bp
Sequence Data
>SC202925 3’UTR clone of NM_000023
The sequence shown below is from the reference sequence of NM_000023. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGGTGCCCCTCATTCTGGACCAGCACTGACAGCCTAGCCAGTGGTTCCAGGTCCAGCCCTGACTTCAT
CCTCCCTTCTCTGTCCACACCACGAGTGGCACATCCCACCTGCTGATTCCAGCTCCTGGCCCTCCTGGA
ACCCAGGCTCTAAACAAGCAGGGAGAGGGGGTGGGGTGGGGTGAGAGTGTGTGGAGTAAGGACATTCAG
AATAAATATCTGCTGCTCTGCTCACCAATTGCTGCTGGCAGCCTCTCCCGTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000023.4
Synonyms 50DAG; adhalin; ADL; DAG2; DMDA2; LGMD2D; LGMDR3; SCARMD1
Summary This gene encodes a component of the dystrophin-glycoprotein complex (DGC), which is critical to the stability of muscle fiber membranes and to the linking of the actin cytoskeleton to the extracellular matrix. Its expression is thought to be restricted to striated muscle. Mutations in this gene result in type 2D autosomal recessive limb-girdle muscular dystrophy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Locus ID 6442
MW 9.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...