CHCHD10 (NM_213720) Human 3' UTR Clone

CAT#: SC202909

3' UTR clone of coiled-coil-helix-coiled-coil-helix domain containing 10 (CHCHD10) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CHCHD10 (NM_213720) Human 3' UTR Clone
Vector pMirTarget
Synonyms C22orf16; FTDALS2; IMMD; MIX17A; N27C7-4; SMAJ
ACCN NM_213720
Insert Size 203 bp
Sequence Data
>SC202909 3’UTR clone of NM_213720
The sequence shown below is from the reference sequence of NM_213720. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACTACCATGGTCTGAGCTCCCTGCCCTGAAGAGGTCGGTGCAGACTCGGGGGCCAGTCCTGCACCCAC
CTCTACCCCTCGCCGACAGCCAGACCACAACACCAGATTGTACCCAGATAGCTGGGATTGGAAGTGAGG
AGGTTTCTCACCCCACAGATAACCCAAGACACAAATGTGCAATTAAAAGTTTATTTTAGACCACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_213720.3
Synonyms C22orf16; FTDALS2; IMMD; MIX17A; N27C7-4; SMAJ
Summary This gene encodes a mitochondrial protein that is enriched at cristae junctions in the intermembrane space. It may play a role in cristae morphology maintenance or oxidative phosphorylation. Mutations in this gene cause frontotemporal dementia and/or amyotrophic lateral sclerosis-2. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 7 and 19. [provided by RefSeq, Aug 2014]
Locus ID 400916
MW 7.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...