Integrin alpha E (ITGAE) (NM_002208) Human 3' UTR Clone

CAT#: SC202887

3' UTR clone of integrin alpha E (antigen CD103 human mucosal lymphocyte antigen 1; alpha polypeptide) (ITGAE) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Integrin alpha E (ITGAE) (NM_002208) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD103; HUMINAE
ACCN NM_002208
Insert Size 249 bp
Sequence Data
>SC202887 3’UTR clone of NM_002208
The sequence shown below is from the reference sequence of NM_002208. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCAGAGAATCTGCTCGAAGAAGAGAATTAGGACCTGCTATCCACTGGGAGAGGCTATCAGCCAGTCCTG
GGACTTGGAGACCCAGCATCCTTTGCATTACTTTTTCCTTCAGGATGATCTAGAGCAGCATGGAGCTGT
TGGTAGAATATTAGTTTTTAACCATACATTGTCCCAAAAGTGTCTGTGCATTGTGCAAAAAGTAAACTT
AGGAAACATTTGGTATTAAATAAATTTACACTTTTCTTTGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002208.5
Synonyms CD103; HUMINAE
Summary Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
Locus ID 3682
MW 9.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...