LRP5 (NM_002335) Human 3' UTR Clone

CAT#: SC202876

3' UTR clone of low density lipoprotein receptor-related protein 5 (LRP5) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name LRP5 (NM_002335) Human 3' UTR Clone
Vector pMirTarget
Synonyms BMND1; EVR1; EVR4; HBM; LR3; LRP-5; LRP-7; LRP7; OPPG; OPS; OPTA1; PCLD4; VBCH2
ACCN NM_002335
Insert Size 235 bp
Sequence Data
>SC202876 3’UTR clone of NM_002335
The sequence shown below is from the reference sequence of NM_002335. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTCCGTCCCCCTGCACGGACTCATCCTGACCTCGGCCGGGCCACTCTGGCTTCTCTGTGCCCCTGTAA
ATAGTTTTAAATATGAACAAAGAAAAAAATATATTTTATGATTTAAAAAATAAATATAATTGGGATTTT
AAAAACATGAGAAATGTGAACTGTGATGGGGTGGGCAGGGCTGGGAGAACTTTGTACAGTGGAGAAATA
TTTATAAACTTAATTTTGTAAAACAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002335.4
Synonyms BMND1; EVR1; EVR4; HBM; LR3; LRP-5; LRP-7; LRP7; OPPG; OPS; OPTA1; PCLD4; VBCH2
Summary This gene encodes a transmembrane low-density lipoprotein receptor that binds and internalizes ligands in the process of receptor-mediated endocytosis. This protein also acts as a co-receptor with Frizzled protein family members for transducing signals by Wnt proteins and was originally cloned on the basis of its association with type 1 diabetes mellitus in humans. This protein plays a key role in skeletal homeostasis and many bone density related diseases are caused by mutations in this gene. Mutations in this gene also cause familial exudative vitreoretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Locus ID 4041
MW 8.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...