COX8A (NM_004074) Human 3' UTR Clone

CAT#: SC202857

3' UTR clone of cytochrome c oxidase subunit 8A (ubiquitous) (COX8A) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name COX8A (NM_004074) Human 3' UTR Clone
Vector pMirTarget
Synonyms COX; COX8; COX8-2; COX8L; MC4DN15; VIII; VIII-L
ACCN NM_004074
Insert Size 253 bp
Sequence Data
>SC202857 3’UTR clone of NM_004074
The sequence shown below is from the reference sequence of NM_004074. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACCTGGAGACCTACAGGAGGCCAGAGTGAAGGGGTCCGTTCTGTCCCTCACACTGTGACCTGACCAGC
CCCACCGGCCCATCCTGGTCATGTTACTGCATTTGTGGCCGGCCTCCCCTGGATCATGTCATTCAATTC
CAGTCACCTCTTCTGCAATCATGACCTCTTGATGTCTCCATGGTGACCTCCTTGGGGGTCACTGACCCT
GCTTGGTGGGGTCCCCCTTGTAACAATAAAATCTATTTAAACTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004074.3
Synonyms COX; COX8; COX8-2; COX8L; MC4DN15; VIII; VIII-L
Summary The protein encoded by this gene is the terminal enzyme of the respiratory chain, coupling the transfer of electrons from cytochrome c to molecular oxygen, with the concomitant production of a proton electrochemical gradient across the inner mitochondrial membrane. In addition to 3 mitochondrially encoded subunits, which perform the catalytic function, the eukaryotic enzyme contains nuclear-encoded smaller subunits, ranging in number from 4 in some organisms to 10 in mammals. It has been proposed that nuclear-encoded subunits may be involved in the modulation of the catalytic function. This gene encodes one of the nuclear-encoded subunits. [provided by RefSeq, Jul 2008]
Locus ID 1351
MW 9.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...