DUSP12 (NM_007240) Human 3' UTR Clone

CAT#: SC202852

3' UTR clone of dual specificity phosphatase 12 (DUSP12) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DUSP12 (NM_007240) Human 3' UTR Clone
Vector pMirTarget
Synonyms DUSP1; YVH1
ACCN NM_007240
Insert Size 321 bp
Sequence Data
>SC202852 3’UTR clone of NM_007240
The sequence shown below is from the reference sequence of NM_007240. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTTTTGGGATCACAAACAGGAAAAATATGAACATGATATTTTATAGCTTGGGAAGAAACTTGCAGATGA
TATGTGCTGCCTTTGCTTCTTATCATTCATGGCAGATTGTTTGTGCTTTCAACATTTCATTTGAAATGG
GAGAAGATAAAATCACTTGATGTAACCTGGAAACTATGCTTTACATGGCAATCAAAGCCTTTTGATCAT
GTACATTTTATTTGATATTAAAATCTTTTATAACCAGATACTGTCTGTGTTTCATATATTTTTAAAAGT
TTTGATTGTTGGAATGTTATATGATCTTAAGGTCTGTATAGACAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_007240.3
Synonyms DUSP1; YVH1
Summary The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product is the human ortholog of the Saccharomyces cerevisiae YVH1 protein tyrosine phosphatase. It is localized predominantly in the nucleus, and is novel in that it contains, and is regulated by a zinc finger domain. [provided by RefSeq, Jul 2008]
Locus ID 11266
MW 12.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...