FGL1 (NM_004467) Human 3' UTR Clone

CAT#: SC202839

3' UTR clone of fibrinogen-like 1 (FGL1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FGL1 (NM_004467) Human 3' UTR Clone
Vector pMirTarget
Synonyms HFREP1; HP-041; HPS; LFIRE-1; LFIRE1
ACCN NM_004467
Insert Size 233 bp
Sequence Data
>SC202839 3’UTR clone of NM_004467
The sequence shown below is from the reference sequence of NM_004467. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCAAATGATTTTATTCCAAATGTAATTTAATTGCTGCTGTTGGGCTTTCGTTTCTGCAATTCAGCTTTG
TTTAAAGTGATTTGAAAAATACTCATTCTGAACATATCCATGCGCAATCATGATAACTGTTGTGAGTAG
TGCTTTTCATTCTTCTCACTTGCCTTTGTTACTTAATGTGCTTTCAGTACAGCAGATATGCAATATTCA
CCAAATAAATGTAGACTGTGTTAATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004467.4
Synonyms HFREP1; HP-041; HPS; LFIRE-1; LFIRE1
Summary Fibrinogen-like 1 is a member of the fibrinogen family. This protein is homologous to the carboxy terminus of the fibrinogen beta- and gamma- subunits which contains the four conserved cysteines of fibrinogens and fibrinogen related proteins. However, this protein lacks the platelet-binding site, cross-linking region and a thrombin-sensitive site which are necessary for fibrin clot formation. This protein may play a role in the development of hepatocellular carcinomas. Four alternatively spliced transcript variants encoding the same protein exist for this gene. [provided by RefSeq, Jul 2008]
Locus ID 2267
MW 8.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...