C19orf46 (SYNE4) (NM_001039876) Human 3' UTR Clone

CAT#: SC202838

3' UTR clone of chromosome 19 open reading frame 46 (C19orf46) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name C19orf46 (SYNE4) (NM_001039876) Human 3' UTR Clone
Vector pMirTarget
Synonyms C19orf46; DFNB76; KASH4; Nesp4
ACCN NM_001039876
Insert Size 60 bp
Sequence Data
>SC202838 3’UTR clone of NM_001039876
The sequence shown below is from the reference sequence of NM_001039876. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGCTATGTCAATGGTCTTCCCCCAGTCTGATGTGTGTAATAAATGGTCACTGTCAAAGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001039876.3
Synonyms C19orf46; DFNB76; KASH4; Nesp4
Summary This gene is a member of the nesprin family of genes, that encode KASH (Klarsicht, Anc-1, Syne Homology) domain-containing proteins. In addition to the KASH domain, this protein also contains a coiled-coil and leucine zipper region, a spectrin repeat, and a kinesin-1 binding region. This protein localizes to the outer nuclear membrane, and is part of the linker of nucleoskeleton and cytoskeleton (LINC) complex in the nuclear envelope. LINC complexes are formed by SUN (Sad1, UNC-84)-KASH pairs, and are thought to mechanically couple nuclear components to the cytoskeleton. Mutations in this gene have been associated with progressive high-frequency hearing loss. The absence of this protein in mice also caused hearing loss, and changes in hair cell morphology in the ears. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Locus ID 163183
MW 2.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...