HRP2 (HDGFRP2) (NM_001001520) Human 3' UTR Clone

CAT#: SC202818

3' UTR clone of hepatoma-derived growth factor-related protein 2 (HDGF2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HRP2 (HDGFRP2) (NM_001001520) Human 3' UTR Clone
Vector pMirTarget
Synonyms HDGF-2; HDGF2; HDGFRP2; HRP-2; HRP2
ACCN NM_001001520
Insert Size 227 bp
Sequence Data
>SC202818 3’UTR clone of NM_001001520
The sequence shown below is from the reference sequence of NM_001001520. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACTCGGAGGCCCTGGACGAGGAGAGCTGAGCCGCGGGCAGCCAGGCCCAGCCCCCGCCCGAGCTCAGG
CTGCCCCTCTCCTTCCCCGGCTCGCAGGAGAGCAGAGCAGAGAACTGTGGGGAACGCTGTGCTGTTTGT
ATTTGTTCCCTTGGGTTTTTTTTTCCTGCCTAATTTCTGTGATTTCCAACCAACATGAAATGACTATAA
ATGGTTTTTTAATGAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001001520.3
Synonyms HDGF-2; HDGF2; HDGFRP2; HRP-2; HRP2
Summary This gene encodes a member of the hepatoma-derived growth factor (HDGF) family. The protein includes an N-terminal PWWP domain that binds to methyl-lysine-containing histones, with specific binding of this protein to tri-methylated lysines 36 and 79 of histone H3, and di- and tri-methylated lysine 20 of histone H4. The protein functions in LEDGF/p75-independent HIV-1 replication by determining HIV-1 integration site selection. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Locus ID 84717
MW 8.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...