NOX3 (NM_015718) Human 3' UTR Clone

CAT#: SC202804

3' UTR clone of NADPH oxidase 3 (NOX3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NOX3 (NM_015718) Human 3' UTR Clone
Vector pMirTarget
Synonyms GP91-3; MOX-2
ACCN NM_015718
Insert Size 264 bp
Sequence Data
>SC202804 3’UTR clone of NM_015718
The sequence shown below is from the reference sequence of NM_015718. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CATTTCTATTACAACAAGGAGAGCTTCTAGACTTTGGAGGTCAAGTCCAGGCATTGTGTTTTCAATCAA
GTTATTGATTCCAAAGAACTCCACCAGGAATTCCTGTGACGGCCTGTTGATATGAGCTCCCAGTTGGGA
ACTGGTGAATAATAATTAACTATTGTGAACAGTACACTATACCATACTTCCTTAGCTTATAAATAACAT
GTCATATACAACAGAACAAAAACATTTACTGAAATTAAAATATATTATGTTTCTCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015718.3
Synonyms GP91-3; MOX-2
Summary This gene encodes a member of the NOX family of NADPH oxidases. These enzymes have the capacity to generate superoxide and other reactive oxygen species (ROS) and transport electrons across the plasma membrane. The ROS generated by family members have been implicated in numerous biological functions including host defense, posttranlational processing of proteins, cellular signaling, regulation of gene expression, and cell differentiation. The protein encoded by this gene is expressed predominantly in the inner ear and is involved in the biogenesis of otoconia/otolith, which are crystalline structures of the inner ear involved in the perception of gravity.[provided by RefSeq, May 2009]
Locus ID 50508
MW 10.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...