MAGED1 (NM_001005333) Human 3' UTR Clone

CAT#: SC202796

3' UTR clone of melanoma antigen family D 1 (MAGED1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MAGED1 (NM_001005333) Human 3' UTR Clone
Vector pMirTarget
Synonyms DLXIN-1; NRAGE
ACCN NM_001005333
Insert Size 247 bp
Sequence Data
>SC202796 3’UTR clone of NM_001005333
The sequence shown below is from the reference sequence of NM_001005333. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGTGCCATTGGTTTCTTCTGGGTTGAGTGAGATGTTGGATATTGCTATCAATCGCAGTAGTCTTTCCCC
TGTGTGAGGCTGAAGCCTCAGATTCCTTCTAAACACAGCTATCTAGAGAGCCACATCCTGTTGACTGAA
AGTGGCATGCAAGATAAATTTATTTGCTGTTCCTTGTCTACTGCTTTTTTTCCCCTTGTGTGCTGTCAA
GTTTTGGTATCAGAAATAAACATTGAAATTGCAAAGTGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001005333.2
Synonyms DLXIN-1; NRAGE
Summary This gene is a member of the melanoma antigen gene (MAGE) family. Most of the genes of this family encode tumor specific antigens that are not expressed in normal adult tissues except testis. Although the protein encoded by this gene shares strong homology with members of the MAGE family, it is expressed in almost all normal adult tissues. This gene has been demonstrated to be involved in the p75 neurotrophin receptor mediated programmed cell death pathway. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 9500
MW 9.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...