RAB25 (NM_020387) Human 3' UTR Clone

CAT#: SC202785

3' UTR clone of RAB25 member RAS oncogene family (RAB25) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RAB25 (NM_020387) Human 3' UTR Clone
Vector pMirTarget
Synonyms CATX-8; RAB11C
ACCN NM_020387
Insert Size 247 bp
Sequence Data
>SC202785 3’UTR clone of NM_020387
The sequence shown below is from the reference sequence of NM_020387. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGAAGAGGGCCTGTTGCATCAGCCTCTGACCTTGGCCAGCACCACCTGCCCCCACTGGCTTTTTGGTG
CCCCTTGTCCCCACTTCAGCCCCAGGACCTTTCCTTGCCCTTTGGTTCCAGATATCAGACTGTTCCCTG
TTCACAGCACCCTCAGGGTCTTAAGGTCTTCATGCCCTATCACAAATACCTCTTTTATCTGTCCACCCC
TCACAGACTAGGACCCTCAAATAAAGCTGTTTTATATCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_020387.4
Synonyms CATX-8; RAB11C
Summary The protein encoded by this gene is a member of the RAS superfamily of small GTPases. The encoded protein is involved in membrane trafficking and cell survival. This gene has been found to be a tumor suppressor and an oncogene, depending on the context. Two variants, one protein-coding and the other not, have been found for this gene. [provided by RefSeq, Nov 2015]
Locus ID 57111
MW 8.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...