APRT (NM_001030018) Human 3' UTR Clone

CAT#: SC202783

3' UTR clone of adenine phosphoribosyltransferase (APRT) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name APRT (NM_001030018) Human 3' UTR Clone
Vector pMirTarget
Synonyms AMP; APRTD
ACCN NM_001030018
Insert Size 263 bp
Sequence Data
>SC202783 3’UTR clone of NM_001030018
The sequence shown below is from the reference sequence of NM_001030018. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGGATGATCTGCTGGCCACTGGTGTATGAGTGACCACAGGGCCTCCCAGCCCAACATCTCCAGCTGGA
TCCCAGGGAAATATCAGCCTTGGGCAACTGCAGTGACCAGGGGCACCGGCTGCCCACAGGGAACACATT
CCTTTGCTGGGGTTCAGCGCCTCTCCTGGGGCTGGAAGTGCCAAAGCCTGGGGCAAAGCTGTGTTTCAG
CCACACTGAACCCAATTACACACAGCGGGAGAACGCAGTAAACAGCTTTCCCACAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001030018.2
Synonyms AMP; APRTD
Summary Adenine phosphoribosyltransferase belongs to the purine/pyrimidine phosphoribosyltransferase family. A conserved feature of this gene is the distribution of CpG dinucleotides. This enzyme catalyzes the formation of AMP and inorganic pyrophosphate from adenine and 5-phosphoribosyl-1-pyrophosphate (PRPP). It also produces adenine as a by-product of the polyamine biosynthesis pathway. A homozygous deficiency in this enzyme causes 2,8-dihydroxyadenine urolithiasis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 353
MW 8.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...