ACYP1 (NM_001107) Human 3' UTR Clone

CAT#: SC202778

3' UTR clone of acylphosphatase 1 erythrocyte (common) type (ACYP1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ACYP1 (NM_001107) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACYPE
ACCN NM_001107
Insert Size 231 bp
Sequence Data
>SC202778 3’UTR clone of NM_001107
The sequence shown below is from the reference sequence of NM_001107. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATTACTCAGACTTCCAAATTGTAAAATAATGGCCTGAATTTAAGTTTTCTAAGATAAACTCAGTGGTT
TGGTTTTTATTATTAATAGAGATAGAACTATTGTGTGTTAATATTAGCATTAGTCAATAAGTTATTTTA
ATGTCAGATTTTTGAATGTTATTATATATTACCTGTATGATGGAAGGATTACCACTGTACACAAATCTA
ATCAATAAAAACGTTAGAACCTTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001107.5
Synonyms ACYPE
Summary This gene is a member of the acylphosphatase family. The encoded protein is a small cytosolic enzyme that catalyzes the hydrolysis of the carboxyl-phosphate bond of acylphosphates. Two isoenzymes have been isolated and described based on their tissue localization: erythrocyte (common) type acylphosphatase encoded by this gene, and muscle type acylphosphatase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Locus ID 97
MW 9.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...