PSMD2 (NM_002808) Human 3' UTR Clone

CAT#: SC202755

3' UTR clone of proteasome (prosome macropain) 26S subunit non-ATPase 2 (PSMD2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PSMD2 (NM_002808) Human 3' UTR Clone
Vector pMirTarget
Synonyms P97; RPN1; S2; TRAP2
ACCN NM_002808
Insert Size 190 bp
Sequence Data
>SC202755 3’UTR clone of NM_002808
The sequence shown below is from the reference sequence of NM_002808. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTTCGGAAGAACCCCAATTATGATCTCTAAGTGACCACCAGGGGCTCTGAACTGCAGCTGATGTTATCA
GCAGGCCATGCATCCTGCTGCCAAGGGTGGACACGGCTGCAGACTTCTGGGGGAATTGTCGCCTCCTGC
TCTTTTGTTACTGAGTGAGATAAGGTTGTTCAATAAAGACTTTTATCCCCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002808.5
Synonyms P97; RPN1; S2; TRAP2
Summary The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. In addition to participation in proteasome function, this subunit may also participate in the TNF signalling pathway since it interacts with the tumor necrosis factor type 1 receptor. A pseudogene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Locus ID 5708
MW 6.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...